Help! Bio vragen

Hey,
Ik heb mijn bio-toets echt ontzettend verknald en moet hem herkansen. Ik probeer nu met examenopdrachten te oefenen, maar ik snap sommige vragen niet, en er staat geen uitleg bij de antwoorden. Kan iemand hier me helpen? Deze vraag snap ik niet:

Katalase-gen ontrafeld
Van veel genen is inmiddels de nucleotidenvolgorde vastgesteld. De gegevens worden volgens een bepaald protocol in grote databases opgeslagen.

Afbeelding 1
In afbeelding 1 is een gedeelte van zo’n protocol met informatie van het katalase-gen van de sojaboon Glycine max weergegeven. Katalase is een enzym dat in de cellen van alle dieren wordt aangetroffen. Het katalyseert de omzetting van het giftige waterstofperoxide in water en zuurstof.

Naast het gedeelte van het gen dat codeert voor de aminozuurvolgorde van de katalase (de exons, onderbroken door introns), bevat het gen nucleotidenvolgordes die betrokken zijn bij de regulatie van de transcriptie van dit gen en delen die fungeren als promotor en terminator. Volgens afspraak wordt in het genprotocol de nucleotidenvolgorde van de coderende streng (het complement van de template of matrijsstreng) weergegeven, in de richting van 5’ naar 3’.

2p 6 Wat is in de coderende DNA-streng van het katalase-gen de basenvolgorde van het startcodon en die van het het stopcodon?
startcodon stopcodon
A ATG TAA
B ATG ATT
C TAC TAA
D TAC ATT
E AUG UAA

Het antwoord is A.

Er staat in het protocol CDS, dus de coderende gebieden inclusief start en stopcodon. Dit betekent dat 1857, 1858 en 1859 samen het startcodon is en 4617, 4618 en 4619 het stopcodon is. :slightly_smiling_face: Als je dan in dat tabel kijkt en telt welke dan zijn, dan zijn dat inderdaad ATG en TAA.

Even kijken of ik het nu wel begrijp, in elk geval super bedankt voor je reactie!

-

Ben ik weer! Weet iemand waarom de repeat gata is en niet bijvoorbeeld ta die je ook overal ziet terugkomen?

D7S280 is one of the 13 core CODIS STR genetic loci. This DNA is found on human chromosome 7. The DNA sequence of a representative allele of this locus is shown below. This sequence comes from GenBank, a public DNA database. The tetrameric repeat sequence of D7S280 is “gata”. Different alleles of this locus have from 6 to 15 tandem repeats of the “gata” sequence. How many tetrameric repeats are present in the DNA sequence shown below? Notice that one of the tetrameric sequences is “gaca”, rather than “gata”.
1 aatttttgta ttttttttag agacggggtt tcaccatgtt ggtcaggctg actatggagt
61 tattttaagg ttaatatata taaagggtat gatagaacac ttgtcatagt ttagaacgaa
121 ctaacgatag atagatagat agatagatag atagatagat agatagatag atagacagat
181 tgatagtttt tttttatctc actaaatagt ctatagtaaa catttaatta ccaatatttg
241 gtgcaattct gtcaatgagg ataaatgtgg aatcgttata attcttaaga atatatattc
301 cctctgagtt tttgatacct cagattttaa ggcc
```

```

Het gaat om tetrameren, dat zijn stukjes van 4, niet van 2

Gaat het dan altijd om tetrameren bij repeats?

Nee niet perse, maar kijk eens hier naar:
gatag atagatagat agatagatag atagatagat agatagatag atagacagat
181 tgata
constant gata achter elkaar, waardoor het dus duidelijk een repeat is. Een stukje dat constant achter elkaar wordt herhaald. ta zie je ook wel regelmatig voorkomen, maar niet steeds achter elkaar.

Wat S zegt. Het is een repeat als er één of meerdere dubbele nucleotiden per ongeluk direct achter de orginele nucleotide geplakt worden. Dus GATATGA kan GATATGAAA worden, dan is A dus één nucleotide die 2x extra geplakt is, of GATATGTAGT, dan heb je 4 nucleotiden (is wat ze hier een tetrameer noemen, tetra staat voor vier) die 1x extra geplakt zijn.

GA is in GATAGA geen repeat, die komt wel een keer terug maar niet direct achter de eerste GA. Foutjes als deze kunnen wel optreden, maar dan vindt het plaats bij hele genen en worden ze jumping genes genoemd, om de eigenschap dat ze dus van de ene DNA strand naar de andere kunnen springen. Jumping nucleotiden bestaan voor zover ik weet niet.

Oh zo, ik heb hem. Super bedankt allebei! :bowing_man:

De basenvolgorde van een stukje coderend DNA met twee ‘genen’, waarbij net als bij de Lgc1-mutatie een hairpin dsRNA kan ontstaan, ziet er als volgt uit:

5’ TTTGTGCCACGAATGATTTACCGTGGCACTCCT 3’

Uit hoeveel basenparen bestaat het deel van dit stukje DNA dat de hairpinvorm van het RNA kan veroorzaken?

A 5
B 6
C 8
D 9
E 11

Waarom is het antwoord C? Heb het ooit begrepen maar ben het helemaal vergeten.

upjee

Nou, een haarpin is dit:

Dus ze vragen naar het stukje dat aan elkaar kleeft. En dat gebeurt alleen wanneer ze basenparen complement aan elkaar zijn, dus: C-G en A-T.
Het stukje wat dikgedrukt en onderstreept is zal aan elkaar vast kleven, want vanaf buiten naar binnen zijn ze complement:
5’ TTTGTGCCACGAATGATTTACCGTGGCACTCCT 3’
ATTGTATTTA zal de lus vormen, dikgedrukt en onderstreepte aan elkaar kleven, en TTT en TCCT de uiteinden.
En als je één dikgedrukt/onderstreept stukje telt, is deze 8 letters lang. Oftewel beiden samen is 8 baseparen!

Oh wat dom, ik vergat dat je het tweede stukje dan andersom moest lezen. Bedankt voor de moeite!